• Question: What does it mean to sequence a genome

    Asked by topquestionsfromchat to Asian Hornet, Daubenton's bat, Giant Hogweed, Leathery Sea Squirt, Lion's Mane Jellyfish, Oak Apple Gallwasp, Turkey Oak on 7 Dec 2017.
    • Photo: Daubenton's Bat

      Daubenton's Bat answered on 7 Dec 2017:

      A genome is an organism’s complete set of genetic instructions. Each genome contains all of the information needed to build that organism and allow it to grow and develop.

      Sequencing a genome basically produces a map that highlights the key ‘landmarks’ in an organism’s genome. A bit like how the London tube map shows the different stops on a tube line to help you get around the city, a genome map helps scientists to navigate their way around the genome.

      There is lots of information about this and the process at: https://www.yourgenome.org/facts – some fascinating stuff!

      We want to sequence the genome of Daubenton’s bats to understand which genes are involved with the bat immune system, how those genes differ from the human immune system and how those differences are expressed in immune system functioning. All of this is to unlock what it is that makes bats special in terms of their immune response to infection and potentially help improve human health.

    • Photo: Turkey Oak

      Turkey Oak answered on 7 Dec 2017:

      All the cells (well almost all, red blood cells, in animals, and xylem vessels, in plants, are exceptions) in living organisms contain a nucleus and within the nucleus are the chromosomes. These chromosomes are made up of DNA and protein. The DNA is a very long molecule made up of 4 different subunits (adenine (A), cytosine (C), guanine (G) and thymine (T)); thus a small piece of DNA could be represented by the following, for example:

      ATTCGACGACCTAATTGCAGTACG

      This ‘string of letters’, which can be millions of letters long, is a code that contains all the information for making the cell, and by extension the organism, that contains it. All of the DNA taken together is called the genome. To sequence a genome means to find out the order of the ‘letters (A, C, G, T) in the DNA.

    • Photo: Asian Hornet

      Asian Hornet answered on 7 Dec 2017:

      Sequencing the genome means identifying the order of millions (sometimes billions) of the letters A, T, G, and C that make up an organism’s DNA. Once we sequence all of the letters we search for special regions in the genome that code for genes. A gene is a region that specifies the code for building a particular protein. And proteins are the molecular machines that make living things! So by sequencing a genome we want to better understand what makes living things appear the way they do.

Comments